Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: Chinese Medicine

Article Title: Ecliptasaponin A alleviates inflammation and fibrosis in experimental MASH mice via targeting the NLRP3 inflammasome and YAP signaling pathway

doi: 10.1186/s13020-025-01321-9

Figure Lengend Snippet: EA inhibited canonical and noncanonical NLRP3 inflammasome activation but has no effect on NLRC4 and AIM2 inflammasome activation. A – C LPS-primed BMDMs were incubated with or without EA (20 µM), followed by the indicated stimuli. Cleaved caspase-1(p20) and mature IL-1β (p17) in supernatant were assessed by western blotting, activity of caspase-1 and IL-1β secretion in the supernatants were analyzed. D – F LPS-primed BMDMs were incubated with or without EA (20 µM), followed by treatment with nigericin, poly (dA: dT) or Salmonella, or Pam3CSK4-primed BMDMs were treated with EA followed by transfection of LPS, cleaved caspase- 1(p20) and mature IL-1β (p17) were assessed by western blotting, activity of caspase-1 and IL-1β secretion in supernatants were evaluated. Data were presented as the mean ± SD (n = 3). ** P < 0.01; NS: not significant

Article Snippet: Primary antibodies against YAP (Abcam, ab205270, 1:1000), COL1A1 (Abcam, ab21286, 1:1000), α-SMA (Proteintech, 14395-1-AP, 1:2000), TAZ (Abcam, ab224239, 1:1000), NLRP3 (Proteintech, 30109-1-AP, 1:2000), Caspase 1 p20 (Proteintech, 22915-1-AP, 1:2000), Caspase 1 p45 (Proteintech, 84735-1-RR, 1:5000), pro-IL-1β (R&D, AF-401-NA, 1:1000), cleaved IL-1β (Cell Signaling Technology, 12242, 1:2000), ASC (Abcam, ab309497, 1:1000) and GAPDH (Proteintech, 60004-1-Ig, 1:5000) were applied, and membranes were incubated overnight at 4 °C.

Techniques: Activation Assay, Incubation, Western Blot, Activity Assay, Transfection

Journal: Nutrients

Article Title: The Clinical Effect of a Propolis and Mangosteen Extract Complex in Subjects with Gingivitis: A Randomized, Double-Blind, and Placebo-Controlled Clinical Trial

doi: 10.3390/nu16173000

Figure Lengend Snippet: Biomarkers in gingival crevicular fluid by measurement time in the PP set.

Article Snippet: The concentrations of IL-1β, PGE2, MMP-8, and MMP-9 in gingival crevicular fluid (GCF) were quantified using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, USA; IL-1β: DY201; PGE2: PKGE004B; MMP-8: DY908; MMP-9: DY911) following the manufacturer’s protocols.

Techniques: Control

Journal: Nutrients

Article Title: The Clinical Effect of a Propolis and Mangosteen Extract Complex in Subjects with Gingivitis: A Randomized, Double-Blind, and Placebo-Controlled Clinical Trial

doi: 10.3390/nu16173000

Figure Lengend Snippet: Biomarkers in gingival crevicular fluid by measurement time in the FA set.

Article Snippet: The concentrations of IL-1β, PGE2, MMP-8, and MMP-9 in gingival crevicular fluid (GCF) were quantified using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, USA; IL-1β: DY201; PGE2: PKGE004B; MMP-8: DY908; MMP-9: DY911) following the manufacturer’s protocols.

Techniques: Control

Journal: Nutrients

Article Title: The Clinical Effect of a Propolis and Mangosteen Extract Complex in Subjects with Gingivitis: A Randomized, Double-Blind, and Placebo-Controlled Clinical Trial

doi: 10.3390/nu16173000

Figure Lengend Snippet: Proposed mechanism of propolis–mangosteen extract complex (PMEC) in mitigating periodontal tissue destruction. PMEC exhibits inhibitory effects on the expression of pro-inflammatory cytokines (IL-1β and PGE2) and metalloproteases (MMP-8 and MMP-9) in oral bacterial-infected periodontal tissue cells, including neutrophils, macrophages, and gingival fibroblasts. This inhibition potentially leads to decreased osteoclastogenesis and enhanced osteogenesis, consequently reducing alveolar bone destruction. However, PMEC does not prevent the direct invasion of periodontal pathogens into gingival tissue cells or the subsequent release of lipopolysaccharides (LPSs) and exotoxins into gingival capillaries. This limitation may explain the discrepancy between clinical parameter outcomes in PMEC treatment and placebo groups, despite significant reductions in gingival crevicular fluid biomarkers (IL-1β, PGE2, MMP-8, and MMP-9) observed in PMEC-treated subjects compared to controls.

Article Snippet: The concentrations of IL-1β, PGE2, MMP-8, and MMP-9 in gingival crevicular fluid (GCF) were quantified using enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, USA; IL-1β: DY201; PGE2: PKGE004B; MMP-8: DY908; MMP-9: DY911) following the manufacturer’s protocols.

Techniques: Expressing, Infection, Inhibition